My mind when reading "The cat is faster and has sharper teeth and nails. It has no code of ethics or consideration for its own future": https://www.youtube.com/watch?v=mhQPzLy5X04
lelgenio
joined 5 years ago
😧😨😰😭
Return of the green cat
You're totally right, it's not good. (I don't know anything about Diablo 4)
Disgusting and incomprehensible, keep up the great work!
< We appreciate the Enthusiasm/Upvote >
< The Beloved/Darling is Tuning in/Harmonizing >
< Wait for Right time/Sequel/Buddies >
The pirate song distorts you
In the thumbnail, jesse-bob looks like a south park version of michael bay.
There will be more controlposting going forward
An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"
Are those dead stingrays?